[HTML][HTML] Complete mitochondrial genome sequence of the Tyrolean Iceman
Summary The Tyrolean Iceman was a witness to the Neolithic–Copper Age transition in
Central Europe 5350–5100 years ago, and his mummified corpse was recovered from an …
Central Europe 5350–5100 years ago, and his mummified corpse was recovered from an …
Complete Mitochondrial Genome Sequence of the Tyrolean Iceman
L Ermini, C Olivieri, E Rizzi, G Corti, R Bonnal… - Current Biology, 2008 - infona.pl
The Tyrolean Iceman was a witness to the Neolithic–Copper Age transition in Central
Europe 5350–5100 years ago, and his mummified corpse was recovered from an Alpine …
Europe 5350–5100 years ago, and his mummified corpse was recovered from an Alpine …
Complete Mitochondrial Genome Sequence of the Tyrolean Iceman
L Ermini, C Olivieri, E Rizzi, G Corti, R Bonnal… - Current …, 2008 - eprints.hud.ac.uk
The Tyrolean Iceman was a witness to the NeolithicCopper Age transition in Central Europe
53505100 years ago, and his mummified corpse was recovered from an Alpine glacier on …
53505100 years ago, and his mummified corpse was recovered from an Alpine glacier on …
Complete Mitochondrial Genome Sequence of the Tyrolean Iceman
L Ermini, C Olivieri, E Rizzi, G Corti, R Bonnal… - Current …, 2008 - ui.adsabs.harvard.edu
The Tyrolean Iceman was a witness to the Neolithic-Copper Age transition in Central Europe
5350-5100 years ago, and his mummified corpse was recovered from an Alpine glacier on …
5350-5100 years ago, and his mummified corpse was recovered from an Alpine glacier on …
[HTML][HTML] Complete Mitochondrial Genome Sequence of the Tyrolean Iceman
L Ermini, C Olivieri, E Rizzi, G Corti, R Bonnal… - Current Biology, 2008 - cell.com
Summary The Tyrolean Iceman was a witness to the Neolithic–Copper Age transition in
Central Europe 5350–5100 years ago, and his mummified corpse was recovered from an …
Central Europe 5350–5100 years ago, and his mummified corpse was recovered from an …
[PDF][PDF] Complete Mitochondrial Genome Sequence of the Tyrolean Iceman
L Ermini, C Olivieri, E Rizzi, G Corti, R Bonnal… - Citeseer
L16518 ATCTGGTTCCTACTTCAGGG H47 CAGACGAAAATACCAAATGC 135 54 L39
TTAACCACTCACGGGAGC H118 TCAAAGACAGATACTGCGAC 118 51 L97 …
TTAACCACTCACGGGAGC H118 TCAAAGACAGATACTGCGAC 118 51 L97 …
Complete Mitochondrial Genome Sequence of the Tyrolean Iceman
L Ermini, C Olivieri, E Rizzi, G Corti, R Bonnal… - Current …, 2008 - pure.hud.ac.uk
Abstract The Tyrolean Iceman was a witness to the Neolithic-Copper Age transition in
Central Europe 5350-5100 years ago, and his mummified corpse was recovered from an …
Central Europe 5350-5100 years ago, and his mummified corpse was recovered from an …
Complete mitochondrial genome sequence of the Tyrolean Iceman
L Ermini, C Olivieri, E Rizzi, G Corti… - Current …, 2008 - pubmed.ncbi.nlm.nih.gov
The Tyrolean Iceman was a witness to the Neolithic-Copper Age transition in Central Europe
5350-5100 years ago, and his mummified corpse was recovered from an Alpine glacier on …
5350-5100 years ago, and his mummified corpse was recovered from an Alpine glacier on …
Complete mitochondrial genome sequence of the Tyrolean Iceman
L Ermini, C Olivieri, E Rizzi, G Corti… - CURRENT …, 2008 - pubblicazioni.unicam.it
The Tyrolean Iceman was a witness to the Neolithic-Copper Age transition in Central Europe
5350-5100 years ago, and his mummified corpse was recovered from an Alpine glacier on …
5350-5100 years ago, and his mummified corpse was recovered from an Alpine glacier on …
[PDF][PDF] Complete Mitochondrial Genome Sequence of the Tyrolean Iceman
L Ermini, C Olivieri, E Rizzi, G Corti, R Bonnal… - Current Biology, 2008 - core.ac.uk
Summary The Tyrolean Iceman was a witness to the Neolithic–Copper Age transition in
Central Europe 5350–5100 years ago, and his mummified corpse was recovered from an …
Central Europe 5350–5100 years ago, and his mummified corpse was recovered from an …