Carrots are widely grown and enjoyed around the world. Purple carrots accumulate rich
anthocyanins in the taproots, while orange, yellow, and red carrots accumulate rich …

4,727,219 A 2/1988 Brar et a1. 5,304,478 A 4/1994 Bird et a1. 5,429,939 A 7/1995 Misawa
et a1. 5,432,069 A 7/1995 Gr? ninger et a1. 5,545,816 A 8/1996 Ausich et a1. 5,618,988 A …

Pg PDATI-SEQID NO: 5 AATCAGAGCTTAAGCTCTAAGGTCCTCCA… CTCCCTCCTCCTCCTCCTTACAGATCAT…
CGATGGCGTTTCTCTGGCGGAGGCGGGC… TCGAAAGAATCCCACTCCAAGAGGGACA …

In Arabidopsis, proanthocyanidins specifically accumulate in the endothelium during early
seed development. At least three TRANSPARENT TESTA (TT) genes, TT2, TT8, and TTG1 …

Figure S1. Overexpression of MYB75 in Arabidopsis increases anthocyanin
accumulation.(A) Overexpression of MYB75 (oxMYB75) results in purple veins against a …

Nucleic acid Sequences and methods are provided for pro ducing plants and Seeds having
altered tocopherol content and compositions. The methods find particular use in increasing …

Background Plant carotenoids are found in the membranes of chloro plasts and
chromoplasts. They are instrumental in the pho toprotective mechanisms of plants. Also …

StMYBA1 from potato tuber was transformed into tobacco (Nicotiana tabacum) with the
CaMV 35S promoter to investigate whether it can regulate anthocyanin biosynthesis in …

The present invention relates to plants with increased levels of water soluble carbohydrates,
particularly fructan, in the stem and leaf sheath. The present invention also provides …

US20170114352A1 - Methods for increasing the anthocyanin content of citrus fruit - Google
Patents US20170114352A1 - Methods for increasing the anthocyanin content of citrus fruit …