Activation of TGF-β1 initiates a program of temporary collagen accumulation important to
wound repair in many organs. However, the outcome of temporary extracellular matrix …

Site-specific recombinase systems (Cre-loxP, Flp-FRT, and φC31-att) are transforming both
forward and reverse genetics in mice. By enabling high-fidelity DNA modifications to be …

Transcription activator-like effectors (TALEs) are a class of naturally occurring DNA-binding
proteins found in the plant pathogen Xanthomonas sp. The DNA-binding domain of each …

Fig. 1 ROSA 26 targeting. a, Top, restriction map of the locus. PCR primers from ROSA26
flanking (5− CCTAAAGAAGAGGCTGTGCTTTGG− 3) and splice acceptor (5 …

Abstract Background Several Cre reporter strains of mice have been described, in which a
lacZ gene is turned on in cells expressing Cre recombinase, as well as their daughter cells …

Myelination of axons by oligodendrocytes enables rapid impulse propagation in the central
nervous system. But long-term interactions between axons and their myelin sheaths are …

Medulloblastomas are among the most common malignancies in childhood, and they are
associated with substantial mortality and morbidity. The molecular pathogenesis as well as …

Conditional DNA excision between two LoxP sites can be achieved in the mouse using Cre-
ERT, a fusion protein between a mutated ligand binding domain of the human estrogen …

Molecular techniques now allow the design of precise genetic modifications in the mouse.
Not only can defined nucleotide changes be engineered into the genome of the mouse, but …

Balanced control of neuronal activity is central in maintaining function and viability of
neuronal circuits. The endocannabinoid system tightly controls neuronal excitability. Here …