TGF-β1 signaling and tissue fibrosis

KK Kim, D Sheppard… - Cold Spring Harbor …, 2018 - cshperspectives.cshlp.org
Activation of TGF-β1 initiates a program of temporary collagen accumulation important to
wound repair in many organs. However, the outcome of temporary extracellular matrix …

Talking about a revolution: The impact of site-specific recombinases on genetic analyses in mice

CS Branda, SM Dymecki - Developmental cell, 2004 - cell.com
Site-specific recombinase systems (Cre-loxP, Flp-FRT, and φC31-att) are transforming both
forward and reverse genetics in mice. By enabling high-fidelity DNA modifications to be …

A transcription activator-like effector toolbox for genome engineering

NE Sanjana, L Cong, Y Zhou, MM Cunniff, G Feng… - Nature protocols, 2012 - nature.com
Transcription activator-like effectors (TALEs) are a class of naturally occurring DNA-binding
proteins found in the plant pathogen Xanthomonas sp. The DNA-binding domain of each …

Generalized lacZ expression with the ROSA26 Cre reporter strain

P Soriano - Nature genetics, 1999 - nature.com
Fig. 1 ROSA 26 targeting. a, Top, restriction map of the locus. PCR primers from ROSA26
flanking (5− CCTAAAGAAGAGGCTGTGCTTTGG− 3) and splice acceptor (5 …

Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus

S Srinivas, T Watanabe, CS Lin, CM William… - BMC developmental …, 2001 - Springer
Abstract Background Several Cre reporter strains of mice have been described, in which a
lacZ gene is turned on in cells expressing Cre recombinase, as well as their daughter cells …

Disruption of Cnp1 uncouples oligodendroglial functions in axonal support and myelination

C Lappe-Siefke, S Goebbels, M Gravel, E Nicksch… - Nature …, 2003 - nature.com
Myelination of axons by oligodendrocytes enables rapid impulse propagation in the central
nervous system. But long-term interactions between axons and their myelin sheaths are …

Induction of medulloblastomas in p53-null mutant mice by somatic inactivation of Rb in the external granular layer cells of the cerebellum

S Marino, M Vooijs, H Van Der Gulden… - Genes & …, 2000 - genesdev.cshlp.org
Medulloblastomas are among the most common malignancies in childhood, and they are
associated with substantial mortality and morbidity. The molecular pathogenesis as well as …

Temporally-controlled site-specific mutagenesis in the basal layer of the epidermis: comparison of the recombinase activity of the tamoxifen-inducible Cre-ERT and …

AK Indra, X Warot, J Brocard, JM Bornert… - Nucleic acids …, 1999 - academic.oup.com
Conditional DNA excision between two LoxP sites can be achieved in the mouse using Cre-
ERT, a fusion protein between a mutated ligand binding domain of the human estrogen …

Inducible gene targeting in mice using the Cre/loxSystem

B Sauer - Methods, 1998 - Elsevier
Molecular techniques now allow the design of precise genetic modifications in the mouse.
Not only can defined nucleotide changes be engineered into the genome of the mouse, but …

The endocannabinoid system controls key epileptogenic circuits in the hippocampus

K Monory, F Massa, M Egertová, M Eder, H Blaudzun… - Neuron, 2006 - cell.com
Balanced control of neuronal activity is central in maintaining function and viability of
neuronal circuits. The endocannabinoid system tightly controls neuronal excitability. Here …